circad | circRNAs associated with diseases

circLARP4
Gene	LARP4	Organism	Human
Genome Locus		Build	hg19
Disease	Hepatocellular Carcinoma	ICD-10	Liver cell carcinoma (C22.0)
DBLink		PMID	30520539
Experimental Method
Sample Type	Tissue and cell lines	Comparison	70 HCC tissues and paired peritumor samples were obtained from HCC patients
Method for Estimation	Quantitative PCR	PCR Details	Detailed Experimental Procedure
Primers (Experimented)	Forward GGGCATCAGGAGCAAACTTA Reverse CTGGCGAATTAAAGCCATTC	Statistics	Fold Change : Upregulated pvalue : <0.05
Citation
Chen, Z, Zuo, X, Pu, L, Zhang, Y, Han, G, Zhang, L, Wu, J, Wang, X (2019). circLARP4 induces cellular senescence through regulating miR-761/RUNX3/p53/p21 signaling in hepatocellular carcinoma. Cancer Sci., 110, 2:568-581.